![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gga-mir-460a |
|||||
Accession | MI0004998 (change log) | ||||
Previous IDs | gga-mir-460 | ||||
Description | Gallus gallus miR-460a stem-loop | ||||
Gene family | MIPF0000134; mir-460 | ||||
Literature search |
![]()
7 open access papers mention gga-mir-460a | ||||
Stem-loop |
----c -a cac ug ca a guua 5' ugacu uauag c cauugua c cugugugu a ||||| ||||| | ||||||| | |||||||| c 3' acuga auguc g guaacau g gacacgua u cacuc ag uua gu ac c aagg |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence gga-miR-460a-5p |
|
Accession | MIMAT0003778 |
Previous IDs | gga-miR-460 |
Sequence |
15 - ccugcauuguacacacugugug - 36 |
Deep sequencing | 38166 reads, 5 experiments |
Evidence | experimental; cloned [1], Illumina [2] |
Predicted targets |
|
Mature sequence gga-miR-460a-3p |
|
Accession | MIMAT0026646 |
Sequence |
52 - cacagcgcauacaauguggauu - 73 |
Deep sequencing | 9082 reads, 5 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:16750530
"Identification of microRNAs from different tissues of chicken embryo and adult chicken"
FEBS Lett. 580:3610-3616(2006).
|
2 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|