![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bmo-mir-282 |
|||||
Accession | MI0004983 (change log) | ||||
Description | Bombyx mori miR-282 stem-loop | ||||
Gene family | MIPF0000150; mir-282 | ||||
Literature search |
![]()
3 open access papers mention bmo-mir-282 | ||||
Stem-loop |
c uuu c ccuu u uuuc u 5' gggac gac uagccucu ggcu ugucug gu a ||||| ||| |||||||| |||| |||||| || g 3' cccug uug auuggaga ccga acagac cg u u -uu c uagu u ---u a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bmo-miR-282-5p |
|
Accession | MIMAT0004205 |
Previous IDs | bmo-miR-282 |
Sequence |
11 - accuagccucuccuuggcuuugucugu - 37 |
Deep sequencing | 72 reads, 3 experiments |
Evidence | experimental; cloned [3], Illumina [4] |
Database links |
|
Mature sequence bmo-miR-282-3p |
|
Accession | MIMAT0015234 |
Previous IDs | bmo-miR-282* |
Sequence |
54 - acauagccugauagagguuacg - 75 |
Deep sequencing | 62 reads, 2 experiments |
Evidence | experimental; Illumina [4] |
Database links |
|
References |
|
1 |
PMID:16972323
"Computational prediction of microRNA genes in silkworm genome"
J Zhejiang Univ Sci B. 7:806-816(2006).
|
2 |
PMID:18507836
"Identification and characteristics of microRNAs from Bombyx mori"
BMC Genomics. 9:248(2008).
|
3 |
PMID:18714353
"The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages"
PLoS One. 3:e2997(2008).
|
4 |
PMID:20199675
"MicroRNAs of Bombyx mori identified by Solexa sequencing"
BMC Genomics. 11:148(2010).
|