Stem-loop sequence bmo-mir-10

Accession

MI0004973 (change log)

Description

Bombyx mori miR-10 stem-loop

Gene family

MIPF0000033; mir-10

Literature search

8 open access papers mention bmo-mir-10
(26 sentences)

Stem-loop

   a    c      cu   -  g    u           ugaa 
5'  gugc cuacau  acc cu uaga ccgaauuuguu    g
    |||| ||||||  ||| || |||| |||||||||||    u
3'  cacg ggugug  ugg ga aucu ggcuuaaacag    g
   g    u      uu   a  g    u           cgga 

Deep sequencing

11959 reads, 1.5e+03 reads per million, 3 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Tong et al erroneously published the reverse complement of the sequence shown here [1].

Genome context

• Coordinates (ASM15162v1; GCA_000151625.1): NW_004582018.1: 2516858-2516941 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0004973

Mature sequence bmo-miR-10-5p

• Accession: MIMAT0004195
• Previous IDs: bmo-miR-10
• Sequence: 15 - acccuguagauccgaauuugu - 35
• Deep sequencing: 3453 reads, 3 experiments
• Evidence: experimental; cloned [3], RT-PCR [4], Illumina [5]
• Database links:
  • RNAcentral:URS0000051B62_7091

Mature sequence bmo-miR-10-3p

• Accession: MIMAT0015226
• Previous IDs: bmo-miR-10*
• Sequence: 50 - caaauucgguucuagagagguuu - 72
• Deep sequencing: 8505 reads, 3 experiments
• Evidence: experimental; Illumina [5]
• Database links:
  • RNAcentral:URS00004D4199_7091

References

1. PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2. PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3. PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
4. PMID:18977439 "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system" Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y Insect Biochem Mol Biol. 38:1066-1071(2008).
5. PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).