![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bmo-mir-1a |
||||||
Accession | MI0004969 (change log) | |||||
Previous IDs | bmo-mir-1 | |||||
Description | Bombyx mori miR-1a stem-loop | |||||
Gene family | MIPF0000038; mir-1 | |||||
Literature search |
![]()
12 open access papers mention bmo-mir-1a | |||||
Stem-loop |
a u a c uuc gucau 5' gccu gcgca guuccgugcuuc uuac ccaua u |||| ||||| |||||||||||| |||| ||||| g 3' cggg cgcgu cgagguaugaag aaug gguau u g - - a uaa acuaa |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence bmo-miR-1a-5p |
|
Accession | MIMAT0015222 |
Previous IDs | bmo-miR-1*;bmo-miR-1a* |
Sequence |
16 - ccgugcuuccuuacuucccau - 36 |
Deep sequencing | 1 reads, 1 experiments |
Evidence | experimental; Illumina [4] |
Mature sequence bmo-miR-1a-3p |
|
Accession | MIMAT0004191 |
Previous IDs | bmo-miR-1;bmo-miR-1a |
Sequence |
53 - uggaauguaaagaaguauggag - 74 |
Deep sequencing | 1138270 reads, 3 experiments |
Evidence | experimental; Northern [2], cloned [3], Illumina [4] |
Database links |
|
References |
|
1 |
PMID:16972323
"Computational prediction of microRNA genes in silkworm genome"
J Zhejiang Univ Sci B. 7:806-816(2006).
|
2 |
PMID:18507836
"Identification and characteristics of microRNAs from Bombyx mori"
BMC Genomics. 9:248(2008).
|
3 |
PMID:18714353
"The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages"
PLoS One. 3:e2997(2008).
|
4 |
PMID:20199675
"MicroRNAs of Bombyx mori identified by Solexa sequencing"
BMC Genomics. 11:148(2010).
|