Stem-loop sequence mmu-mir-652

Accession

MI0004965 (change log)

Symbol

MGI:Mir652

Description

Mus musculus miR-652 stem-loop

Gene family

MIPF0000333; mir-652

Literature search

12 open access papers mention mmu-mir-652
(22 sentences)

Stem-loop

   aggaaca   a                  gaggg           ca  g 
5'        gcu uguacugcacaacccuag     ggugccauuca  ua a
          ||| ||||||||||||||||||     |||||||||||  || g
3'        cga augugacguguugggauc     ccgcgguaagu  au u
   -cacauc   c                  ----a           ua  a 

Deep sequencing

128511 reads, 521 reads per million, 107 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The predominant miRNA cloned by Langraf et al. has a 3' terminal U residue, which is incompatible with the genome sequence [2].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chrX: 142739000-142739097 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000045328 ; Tmem164-003; intron 1

  OTTMUST00000045330 ; Tmem164-005; intron 1

  OTTMUST00000045329 ; Tmem164-004; intron 1

  OTTMUST00000045377 ; Tmem164-009; intron 1

  OTTMUST00000045311 ; Tmem164-001; intron 2

  OTTMUST00000045331 ; Tmem164-002; intron 2

  OTTMUST00000045310 ; Tmem164-007; intron 2

  ENSMUST00000112889 ; Tmem164-003; intron 1

  ENSMUST00000101198 ; Tmem164-005; intron 1

  ENSMUST00000112891 ; Tmem164-004; intron 1

  ENSMUST00000124211 ; Tmem164-009; intron 1

  ENSMUST00000087333 ; Tmem164-001; intron 2

  ENSMUST00000112896 ; Tmem164-002; intron 2

  ENSMUST00000133634 ; Tmem164-007; intron 2

Database links

• EntrezGene:Mir652
• MGI:Mir652
• RNAcentral:URS00006C8DAD_10090
• miRBase Tracker:MI0004965

Mature sequence mmu-miR-652-5p

• Accession: MIMAT0017260
• Previous IDs: mmu-miR-652*
• Sequence: 21 - caacccuaggagggggugccauuc - 44
• Deep sequencing: 423 reads, 68 experiments
• Evidence: experimental; 454 [4], Illumina [5]
• Database links:
  • RNAcentral:URS00004BC973_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-652-5p
  • miRDB:mmu-miR-652-5p

Mature sequence mmu-miR-652-3p

• Accession: MIMAT0003711
• Previous IDs: mmu-miR-652
• Sequence: 61 - aauggcgccacuaggguugug - 81
• Deep sequencing: 128013 reads, 107 experiments
• Evidence: experimental; cloned [2], Illumina [3,5]
• Database links:
  • RNAcentral:URS0000013DD8_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-652-3p
  • miRDB:mmu-miR-652-3p
  • microrna.org:mmu-miR-652-3p

References

1. PMID:16566924 "Identification of new central nervous system specific mouse microRNAs" Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T FEBS Lett. 580:2195-2200(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).