miRBase entry: mmu-mir-652

Stem-loop mmu-mir-652


Accession
MI0004965
Symbol
MGI: Mir652
Description
Mus musculus mmu-mir-652 precursor miRNA
Gene family
MIPF0000333; mir-652

Literature search
12 open access papers mention mmu-mir-652
(22 sentences)

Sequence

78918 reads, 544 reads per million, 104 experiments
aggaacagcuauguacugcaCAACCCUAGGAGGGGGUGCCAUUCacauagaguauaauugAAUGGCGCCACUAGGGUUGUGcaguguacagccuacac
.......(((.((((((((((((((((((.....(((((((((((..((.....))..))))))))))).)))))))))))))))))).)))......

Structure
aggaaca   a                  GAGGG           ca  g 
       gcu uguacugcaCAACCCUAG     GGUGCCAUUCa  ua a
       ||| ||||||||||||||||||     |||||||||||  || g
       cga augugacGUGUUGGGAUC     CCGCGGUAAgu  au u
-cacauc   c                  ----A           ua  a 


Annotation confidence High
Do you think this miRNA is real?
Comments
The predominant miRNA cloned by Langraf et al. has a 3' terminal U residue, which is incompatible with the genome sequence [2].

Genome context
chrX: 142739000-142739097 [+]

Database links

Mature mmu-miR-652-5p

Accession MIMAT0017260
Description Mus musculus mmu-miR-652-5p mature miRNA
Sequence 21 - CAACCCUAGGAGGGGGUGCCAUUC - 44
Evidence experimental
454 [4], Illumina [5]
Database links
Predicted targets

Mature mmu-miR-652-3p

Accession MIMAT0003711
Description Mus musculus mmu-miR-652-3p mature miRNA
Sequence 61 - AAUGGCGCCACUAGGGUUGUG - 81
Evidence experimental
cloned [2], Illumina [3,5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275

  5. PubMed ID: 16566924
    Identification of new central nervous system specific mouse microRNAs
    "Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T"
    "FEBS Lett (2006) 580:2195-2200