Stem-loop sequence bta-mir-30b

AccessionMI0004761 (change log)
DescriptionBos taurus miR-30b stem-loop
Gene family MIPF0000005; mir-30
Literature search

27 open access papers mention bta-mir-30b
(152 sentences)

Stem-loop 
   -     uuu      cau          u  -a        ua  ac 
5'  ccaag   ucaguu   guaaacaucc ac  cucagcug  ac  a
    |||||   ||||||   |||||||||| ||  ||||||||  ||   
3'  gguuc   agucga   cauuuguagg ug  gggucggc  ug  c
   a     ---      cuu          -  ga        --  ag
Get sequence
Deep sequencing
61442 reads, 925 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

High-throughput sequencing suggests that the dominant miRNA arises from the 3' arm of this precursor [2], in contrast to earlier cloning studies.

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr14: 8145856-8145943 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-30b
bta-mir-30dchr14: 8141427-8141496 [+]
bta-mir-30bchr14: 8145856-8145943 [+]
Database links

Mature sequence bta-miR-30b-5p

Accession MIMAT0003547
Previous IDsbta-miR-30b
Sequence

17 -  

uguaaacauccuacacucagcu

 - 38

Get sequence
Deep sequencing61211 reads, 77 experiments
Evidence experimental; cloned [1-2], Illumina [3]
Predicted targets

Mature sequence bta-miR-30b-3p

Accession MIMAT0012534
Sequence

55 -  

cugggagguggauguuuacuu

 - 75

Get sequence
Deep sequencing216 reads, 33 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
3
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).