![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-128-1 |
|||||
Accession | MI0004755 (change log) | ||||
Previous IDs | bta-mir-128a;bta-mir-128 | ||||
Description | Bos taurus miR-128-1 stem-loop | ||||
Gene family | MIPF0000048; mir-128 | ||||
Literature search |
![]()
7 open access papers mention bta-mir-128-1 | ||||
Stem-loop |
u u uuc uag cu u 5' gagc guugga ggggccg cacugu gagaggu u |||| |||||| ||||||| |||||| ||||||| 3' uucg cgacuu cucuggc gugaca cucuuua a c u uuu caa -- c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-128 |
|
Accession | MIMAT0003541 |
Previous IDs | bta-miR-128a |
Sequence |
50 - ucacagugaaccggucucuuu - 70 |
Deep sequencing | 44102 reads, 74 experiments |
Evidence | experimental; Array [2], qRT-PCR [2], cloned [3] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:19170227
"Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach"
Mol Reprod Dev. 76:665-677(2009).
|