![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-125b-1 |
|||||
Accession | MI0004753 (change log) | ||||
Previous IDs | bta-mir-125b | ||||
Description | Bos taurus miR-125b-1 stem-loop | ||||
Gene family | MIPF0000033; mir-10 | ||||
Literature search |
![]()
35 open access papers mention bta-mir-125b-1 | ||||
Stem-loop |
c c u -a u c au c 5' gcgcg cuc ca uccc gaga ccuaacuugug guuua c ||||| ||| || |||| |||| ||||||||||| ||||| g 3' cgcgc gag gu aggg uucu ggauugggcac uaaau u c u c cg - c -c u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-125b |
|
Accession | MIMAT0003539 |
Sequence |
15 - ucccugagacccuaacuuguga - 36 |
Deep sequencing | 321610 reads, 77 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|
3 |
PMID:19267191
"Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"
Biochem Genet. 47:329-343(2009).
|