Stem-loop sequence bta-mir-125b-1

AccessionMI0004753 (change log)
Previous IDsbta-mir-125b
DescriptionBos taurus miR-125b-1 stem-loop
Gene family MIPF0000033; mir-10
Literature search

35 open access papers mention bta-mir-125b-1
(117 sentences)

Stem-loop 
   c     c   u  -a    u    c           au     c 
5'  gcgcg cuc ca  uccc gaga ccuaacuugug  guuua c
    ||||| ||| ||  |||| |||| |||||||||||  ||||| g
3'  cgcgc gag gu  aggg uucu ggauugggcac  uaaau u
   c     u   c  cg    -    c           -c     u
Get sequence
Deep sequencing
162774 reads, 1.56e+03 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 33484663-33484750 [-]
intergenic
Database links

Mature sequence bta-miR-125b

Accession MIMAT0003539
Sequence

15 -  

ucccugagacccuaacuuguga

 - 36

Get sequence
Deep sequencing321610 reads, 77 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
3
PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).