Stem-loop sequence bta-mir-320a-2

Accession

MI0004748 (change log)

Previous IDs

bta-mir-320

Description

Bos taurus miR-320a-2 stem-loop

Gene family

MIPF0000163; mir-320

Literature search

15 open access papers mention bta-mir-320a-2
(70 sentences)

Stem-loop

   aaaaacgaaaaagag        uu       c      g 
5'                gccuucuc  cccgguu uucccg a
                  ||||||||  ||||||| ||||||  
3'                cgggagag  gggucga aagggc g
   gggagaaggaaaaag        uu       a      u 

Deep sequencing

112446 reads, 1.14e+03 reads per million, 78 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr20: 15289880-15289961 [+]
• Overlapping transcripts:

  antisense

  ENSBTAT00000061221 ; RNF180-201; intron 4

Database links

• EntrezGene:MIR320
• RNAcentral:URS0000683D9C_9913
• miRBase Tracker:MI0004748

Mature sequence bta-miR-320a

• Accession: MIMAT0003534
• Previous IDs: bta-miR-320
• Sequence: 48 - aaaagcuggguugagagggcga - 69
• Deep sequencing: 224629 reads, 78 experiments
• Evidence: experimental; cloned [2]
• Predicted targets:
  • TargetScanVert:bta-miR-320a

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2. PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).