Stem-loop sequence bta-mir-148a

AccessionMI0004737 (change log)
DescriptionBos taurus miR-148a stem-loop
Gene family MIPF0000056; mir-148
Literature search

33 open access papers mention bta-mir-148a
(198 sentences)

Stem-loop 
                 -  -a    cc    -   aa 
5' gaggcaaaguucug ag  cacu  gacu cug  u
   |||||||||||||| ||  ||||  |||| |||  a
3' cucuguuucaagac uc  guga  cuga gau  u
                 a  ac    --    a   ag
Get sequence
Deep sequencing
1499193 reads, 2.84e+04 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 70663557-70663624 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-148a
bta-mir-148achr4: 70663557-70663624 [+]
bta-mir-148dchr4: 70663559-70663619 [-]
Database links

Mature sequence bta-miR-148a

Accession MIMAT0003522
Sequence

44 -  

ucagugcacuacagaacuuugu

 - 65

Get sequence
Deep sequencing1486640 reads, 78 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).