![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-101-2 |
|||||
Accession | MI0004735 (change log) | ||||
Previous IDs | bta-mir-101 | ||||
Description | Bos taurus miR-101-2 stem-loop | ||||
Gene family | MIPF0000046; mir-101 | ||||
Literature search |
![]()
14 open access papers mention bta-mir-101-2 | ||||
Stem-loop |
ug c c a guaua 5' ac uc uuuuucgguuaucaugguac g ugcu u || || |||||||||||||||||||| | |||| 3' ug gg aagaagucaauagugucaug c augg c gu u a - aaagu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-101 |
|
Accession | MIMAT0003520 |
Sequence |
49 - uacaguacugugauaacugaa - 69 |
Deep sequencing | 426357 reads, 78 experiments |
Evidence | experimental; cloned [2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|