Stem-loop sequence bta-mir-26a-2

AccessionMI0004731 (change log)
Previous IDsbta-mir-26a
DescriptionBos taurus miR-26a-2 stem-loop
Gene family MIPF0000043; mir-26
Literature search

42 open access papers mention bta-mir-26a-2
(124 sentences)

Stem-loop 
         gg ug  uu         c          guuucc 
5' ggcugu  c  ga  caaguaauc aggauaggcu      a
   ||||||  |  ||  ||||||||| ||||||||||       
3' ucgacg  g  cu  guucauuag ucuuauccgg      u
         ga gu  uu         u          aguguc
Get sequence
Deep sequencing
2434238 reads, 2.95e+04 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 56156321-56156404 [+]
sense
ENSBTAT00000038164 ; CTDSP2-201; intron 5
Database links

Mature sequence bta-miR-26a

Accession MIMAT0003516
Sequence

14 -  

uucaaguaauccaggauaggcu

 - 35

Get sequence
Deep sequencing4867811 reads, 78 experiments
Evidence experimental; cloned [2-3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
3
PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).