![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-26a-2 |
|||||
Accession | MI0004731 (change log) | ||||
Previous IDs | bta-mir-26a | ||||
Description | Bos taurus miR-26a-2 stem-loop | ||||
Gene family | MIPF0000043; mir-26 | ||||
Literature search |
![]()
42 open access papers mention bta-mir-26a-2 | ||||
Stem-loop |
gg ug uu c guuucc 5' ggcugu c ga caaguaauc aggauaggcu a |||||| | || ||||||||| |||||||||| 3' ucgacg g cu guucauuag ucuuauccgg u ga gu uu u aguguc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-26a |
|
Accession | MIMAT0003516 |
Sequence |
14 - uucaaguaauccaggauaggcu - 35 |
Deep sequencing | 4867811 reads, 78 experiments |
Evidence | experimental; cloned [2-3] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|
3 |
PMID:19267191
"Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"
Biochem Genet. 47:329-343(2009).
|