Stem-loop sequence ppt-MIR1218

AccessionMI0004717 (change log)
DescriptionPhyscomitrella patens miR1218 stem-loop
Literature search

1 open access papers mention ppt-MIR1218
(1 sentences)

Stem-loop
      u    aca   g   u      c   c              cu     -  -gaa        ag u 
5' cag gauu   ugu ucg gguagg auc uuagagucguaggc  cugug ug    uucaagau  u c
   ||| ||||   ||| ||| |||||| ||| ||||||||||||||  ||||| ||    ||||||||  | a
3' guc uuaa   aca ggc cuaucc uag agucucagcauccg  gacac ac    aaguuuug  g c
      u    ---   g   u      a   a              ag     u  acac        cu a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr24: 13118494-13118631 [-]
intergenic
Database links

Mature sequence ppt-miR1218

Accession MIMAT0003907
Sequence

29 - 

ccuuagagucguaggccucug

 - 49

Get sequence
Evidence experimental; Northern [1], cloned [2], 454 [3]

References

1
PMID:16824179 "Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss" Talmor-Neiman M, Stav R, Frank W, Voss B, Arazi T Plant J. 47:25-37(2006).
2
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
3
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).