Stem-loop sequence ppt-MIR1212

AccessionMI0004711 (change log)
DescriptionPhyscomitrella patens miR1212 stem-loop
Literature search

1 open access papers mention ppt-MIR1212
(1 sentences)

Stem-loop
   g  ug    g      c  c      g     a    -    g c 
5'  ua  agga uugcau cu ugcugu cccac ugcg ucgu g g
    ||  |||| |||||| || |||||| ||||| |||| |||| |  
3'  au  uccu ggcgua ga acgaca gggug gcgc ggcg u c
   -  gu    a      a  u      -     c    c    g g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr13: 2520122-2520210 [+]
intergenic
Database links

Mature sequence ppt-miR1212

Accession MIMAT0003901
Sequence

59 - 

cgugggacagcauagaaugcg

 - 79

Get sequence
Evidence experimental; Northern [1], cloned [2], 454 [3]

References

1
PMID:16824179 "Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss" Talmor-Neiman M, Stav R, Frank W, Voss B, Arazi T Plant J. 47:25-37(2006).
2
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
3
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).