miRBase entry: mmu-mir-501

Stem-loop mmu-mir-501


Accession
MI0004703
Symbol
MGI: Mir501
Description
Mus musculus mmu-mir-501 precursor miRNA
Gene family
MIPF0000139; mir-500

Literature search
12 open access papers mention mmu-mir-501
(76 sentences)

Sequence

42904 reads, 236 reads per million, 104 experiments
cuucugcucugcucauccucucuAAUCCUUUGUCCCUGGGUGAAAaugcuauuuguaugcAAUGCACCCGGGCAAGGAUUUGgggaaggugagccugaucugcauggag
(((((((((.(((((((.(((((((..(((((.(((.(((((....(((.........)))...)))))))))))))..))))))).)))))))..))...))).))))

Structure
    -   ---  -u       c       UC     U   U     AAAa   uau 
cuuc ugc   uc  gcucauc ucucuAA  CUUUG CCC GGGUG    ugc   u
|||| |||   ||  ||||||| |||||||  ||||| ||| |||||    |||   u
gagg acg   ag  cgagugg agggGUU  GGAAC GGG CCCAC    Acg   g
    u   ucu  uc       a       UA     -   -     -GUA   uau 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 7241243-7241351 [-]
Clustered miRNAs
4 other miRNAs are < 10 kb from mmu-mir-501
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-501-5p

Accession MIMAT0003508
Description Mus musculus mmu-miR-501-5p mature miRNA
Sequence 24 - AAUCCUUUGUCCCUGGGUGAAA - 45
Evidence experimental
cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-501-3p

Accession MIMAT0003509
Description Mus musculus mmu-miR-501-3p mature miRNA
Sequence 61 - AAUGCACCCGGGCAAGGAUUUG - 82
Evidence experimental
MPSS [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771