![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-500 |
||||||||
Accession | MI0004702 (change log) | |||||||
Symbol | MGI:Mir500 | |||||||
Description | Mus musculus miR-500 stem-loop | |||||||
Gene family | MIPF0000139; mir-500 | |||||||
Literature search |
6 open access papers mention mmu-mir-500 | |||||||
Stem-loop |
cuccucu c c - uau ug uuag uau 5' gcuc cc ucucu aauccuugc c ggugc ugc c |||| || ||||| ||||||||| | ||||| ||| u 3' cgag gg agaga uugggaacg g ccacg acg c ------- u a c --- gu --ua uaa |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
Mouse miR-500 was identified independently by two groups. Wheeler et al cloned a mature product with the same length as the human ortholog (MI0003184) [1]. Mineno et al report a shorter mature product with 1 additional base at the 5' end and 3 fewer at the 3' end (AAUGCACCUGGGCAAGGGUU), referred to as miR-500b in [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence mmu-miR-500-5p |
|
Accession | MIMAT0017258 |
Previous IDs | mmu-miR-500* |
Sequence |
21 - aauccuugcuaucugggugcuuagu - 45 |
Deep sequencing | 356 reads, 64 experiments |
Evidence | experimental; 454 [5], Illumina [6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-500-3p |
|
Accession | MIMAT0003507 |
Previous IDs | mmu-miR-500 |
Sequence |
59 - aaugcaccugggcaaggguuca - 80 |
Deep sequencing | 43406 reads, 105 experiments |
Evidence | experimental; cloned [1,3], insitu [1], Northern [1], MPSS [2], Illumina [4,6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16566924
"Identification of new central nervous system specific mouse microRNAs"
FEBS Lett. 580:2195-2200(2006).
|
2 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|