Stem-loop sequence mmu-mir-500

AccessionMI0004702 (change log)
Symbol MGI:Mir500
DescriptionMus musculus miR-500 stem-loop
Gene family MIPF0000139; mir-500
Literature search

6 open access papers mention mmu-mir-500
(9 sentences)

Stem-loop 
   cuccucu    c  c     -         uau ug     uuag   uau 
5'        gcuc cc ucucu aauccuugc   c  ggugc    ugc   c
          |||| || ||||| |||||||||   |  |||||    |||   u
3'        cgag gg agaga uugggaacg   g  ccacg    acg   c
   -------    u  a     c         --- gu     --ua   uaa
Get sequence
Deep sequencing
43785 reads, 150 reads per million, 105 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse miR-500 was identified independently by two groups. Wheeler et al cloned a mature product with the same length as the human ortholog (MI0003184) [1]. Mineno et al report a shorter mature product with 1 additional base at the 5' end and 3 fewer at the 3' end (AAUGCACCUGGGCAAGGGUU), referred to as miR-500b in [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 7237683-7237774 [-]
sense
OTTMUST00000039775 ; Clcn5-003; intron 2
OTTMUST00000039776 ; Clcn5-004; intron 3
OTTMUST00000039777 ; Clcn5-005; intron 3
ENSMUST00000128319 ; Clcn5-003; intron 2
ENSMUST00000115746 ; Clcn5-004; intron 3
ENSMUST00000132126 ; Clcn5-005; intron 3
Clustered miRNAs
< 10kb from mmu-mir-500
mmu-mir-362chrX: 7241982-7242046 [-]
mmu-mir-501chrX: 7241243-7241351 [-]
mmu-mir-500chrX: 7237683-7237774 [-]
Database links

Mature sequence mmu-miR-500-5p

Accession MIMAT0017258
Previous IDsmmu-miR-500*
Sequence

21 -  

aauccuugcuaucugggugcuuagu

 - 45

Get sequence
Deep sequencing356 reads, 64 experiments
Evidence experimental; 454 [5], Illumina [6]
Database links
Predicted targets

Mature sequence mmu-miR-500-3p

Accession MIMAT0003507
Previous IDsmmu-miR-500
Sequence

59 -  

aaugcaccugggcaaggguuca

 - 80

Get sequence
Deep sequencing43406 reads, 105 experiments
Evidence experimental; cloned [1,3], insitu [1], Northern [1], MPSS [2], Illumina [4,6]
Database links
Predicted targets

References

1
PMID:16566924 "Identification of new central nervous system specific mouse microRNAs" Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T FEBS Lett. 580:2195-2200(2006).
2
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).