Stem-loop sequence mmu-mir-708

Accession

MI0004692 (change log)

Symbol

MGI:Mir708

Description

Mus musculus miR-708 stem-loop

Gene family

MIPF0000397; mir-708

Literature search

28 open access papers mention mmu-mir-708
(210 sentences)

Stem-loop

   cuguguuugaaa     --a        a           a     c  g gg   a  a 
5'             ugggg   cugcccuc aggagcuuaca ucuag ug g  uag ug c
               |||||   |||||||| ||||||||||| ||||| || |  ||| || u
3'             auucc   gacgggag ucuucgagugu agauc ac c  guu ac u
   ------------     ggg        a           c     a  a aa   c  g 

Deep sequencing

90505 reads, 374 reads per million, 94 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr7: 96249424-96249532 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000050320 ; Odz4-001; intron 1

  OTTMUST00000050321 ; Odz4-002; intron 1

  OTTMUST00000050322 ; Odz4-003; intron 1

  OTTMUST00000050323 ; Odz4-004; intron 1

  OTTMUST00000050347 ; Odz4-009; intron 1

  OTTMUST00000050348 ; Odz4-010; intron 1

  OTTMUST00000050349 ; Odz4-011; intron 1

  ENSMUST00000107162 ; Tenm4-001; intron 1

  ENSMUST00000144263 ; Tenm4-003; intron 1

  ENSMUST00000133770 ; Tenm4-011; intron 1

  ENSMUST00000129445 ; Tenm4-002; intron 1

  ENSMUST00000138760 ; Tenm4-004; intron 1

  ENSMUST00000107166 ; Tenm4-009; intron 1

  ENSMUST00000107165 ; Tenm4-010; intron 1

Database links

• EntrezGene:Mir708
• MGI:Mir708
• RNAcentral:URS000075EA54_10090
• miRBase Tracker:MI0004692

Mature sequence mmu-miR-708-5p

• Accession: MIMAT0004828
• Previous IDs: mmu-miR-708
• Sequence: 27 - aaggagcuuacaaucuagcuggg - 49
• Deep sequencing: 67027 reads, 88 experiments
• Evidence: experimental; cloned [3], Illumina [4-5]
• Database links:
  • RNAcentral:URS000019D79B_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-708-5p
  • miRDB:mmu-miR-708-5p
  • microrna.org:mmu-miR-708-5p

Mature sequence mmu-miR-708-3p

• Accession: MIMAT0003498
• Previous IDs: mmu-miR-708;mmu-miR-708*
• Sequence: 73 - caacuagacugugagcuucuag - 94
• Deep sequencing: 22139 reads, 71 experiments
• Evidence: experimental; MPSS [1], miRAP-cloned [2], cloned [3], Illumina [4-5]
• Database links:
  • RNAcentral:URS000049EEDF_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-708-3p
  • miRDB:mmu-miR-708-3p
  • microrna.org:mmu-miR-708-3p

References

1. PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2. PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).