Stem-loop sequence mmu-mir-702

AccessionMI0004686 (change log)
Symbol MGI:Mir702
DescriptionMus musculus miR-702 stem-loop
Gene family MIPF0001163; mir-702
Literature search

6 open access papers mention mmu-mir-702
(11 sentences)

Stem-loop 
   cgggacaaggu           uu  ca     -   ccau  -    -  --  c     g 
5'            gaguggggugg  gg  ugggu ugc    gg ggac uc  ga gcugu c
              |||||||||||  ||  ||||| |||    || |||| ||  || |||||  
3'            cucgccccauu  cc  acccg acg    cc ccug ag  cu cgaca c
   ----------c           uc  --     u   cacu  u    u  uc  c     c
Get sequence
Deep sequencing
846 reads, 6.1 reads per million, 82 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 136991433-136991541 [+]
sense
OTTMUST00000056811 ; Plod3-004; exon 4
OTTMUST00000056812 ; Plod3-005; exon 4
OTTMUST00000056810 ; Plod3-003; exon 12
OTTMUST00000056808 ; Plod3-001; 3'UTR (exon 13)
OTTMUST00000056809 ; Plod3-002; exon 13
ENSMUST00000151642 ; Plod3-004; exon 4
ENSMUST00000137419 ; Plod3-005; exon 4
ENSMUST00000144784 ; Plod3-003; exon 12
ENSMUST00000004968 ; Plod3-001; 3'UTR (exon 13)
ENSMUST00000129896 ; Plod3-002; exon 13
Database links

Mature sequence mmu-miR-702-5p

Accession MIMAT0022931
Sequence

10 -  

gugaguggggugguuggcaug

 - 30

Get sequence
Deep sequencing375 reads, 59 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence mmu-miR-702-3p

Accession MIMAT0003492
Previous IDsmmu-miR-702
Sequence

88 -  

ugcccacccuuuaccccgcucc

 - 109

Get sequence
Deep sequencing461 reads, 63 experiments
Evidence experimental; MPSS [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).