![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-700 |
|||||
Accession | MI0004684 (change log) | ||||
Symbol | MGI:Mir700 | ||||
Description | Mus musculus miR-700 stem-loop | ||||
Literature search |
![]()
7 open access papers mention mmu-mir-700 | ||||
Stem-loop |
uuc a aa -c cu --ggg g 5' acuggg gu ggcuc uuccugug ugcag a a |||||| || ||||| |||||||| ||||| | 3' ugaccc ca cugag aagggcgc acguc u a --- c -c cc -- aagca a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-700-5p |
|
Accession | MIMAT0017256 |
Previous IDs | mmu-miR-700* |
Sequence |
12 - uaaggcuccuuccugugcuugc - 33 |
Deep sequencing | 3752 reads, 97 experiments |
Evidence | experimental; 454 [3], Illumina [4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-700-3p |
|
Accession | MIMAT0003490 |
Previous IDs | mmu-miR-700 |
Sequence |
53 - cacgcgggaaccgaguccacc - 73 |
Deep sequencing | 5619 reads, 98 experiments |
Evidence | experimental; MPSS [1], Illumina [2,4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
2 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
3 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|