Stem-loop sequence mmu-mir-700

Accession

MI0004684 (change log)

Symbol

MGI:Mir700

Description

Mus musculus miR-700 stem-loop

Literature search

7 open access papers mention mmu-mir-700
(12 sentences)

Stem-loop

   uuc      a  aa     -c        cu     --ggg g 
5'    acuggg gu  ggcuc  uuccugug  ugcag     a a
      |||||| ||  |||||  ||||||||  |||||     |  
3'    ugaccc ca  cugag  aagggcgc  acguc     u a
   ---      c  -c     cc        --     aagca a 

Deep sequencing

9416 reads, 9.8 reads per million, 102 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr4: 135416555-135416633 [-]
• Overlapping transcripts:

  sense

  OTTMUST00000070708 ; Rcan3-003; intron 3

  OTTMUST00000022473 ; Rcan3-001; exon 5

  ENSMUST00000132654 ; Rcan3-003; intron 3

  ENSMUST00000030606 ; Rcan3-001; exon 5

Database links

• EntrezGene:Mir700
• MGI:Mir700
• RNAcentral:URS000075A134_10090
• miRBase Tracker:MI0004684

Mature sequence mmu-miR-700-5p

• Accession: MIMAT0017256
• Previous IDs: mmu-miR-700*
• Sequence: 12 - uaaggcuccuuccugugcuugc - 33
• Deep sequencing: 3752 reads, 97 experiments
• Evidence: experimental; 454 [3], Illumina [4]
• Database links:
  • RNAcentral:URS00001AE6A4_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-700-5p
  • miRDB:mmu-miR-700-5p

Mature sequence mmu-miR-700-3p

• Accession: MIMAT0003490
• Previous IDs: mmu-miR-700
• Sequence: 53 - cacgcgggaaccgaguccacc - 73
• Deep sequencing: 5619 reads, 98 experiments
• Evidence: experimental; MPSS [1], Illumina [2,4]
• Database links:
  • RNAcentral:URS000023F9BF_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-700-3p
  • miRDB:mmu-miR-700-3p
  • microrna.org:mmu-miR-700-3p

References

1. PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).