Stem-loop sequence mmu-mir-455

AccessionMI0004679 (change log)
Symbol MGI:Mir455
DescriptionMus musculus miR-455 stem-loop
Gene family MIPF0000129; mir-455
Literature search

41 open access papers mention mmu-mir-455
(490 sentences)

Stem-loop
   cucccu  u ug  c          u      a   c   aa 
5'       gg g  ag guaugugccu uggacu cau gug  c
         || |  || |||||||||| |||||| ||| |||  g
3'       cu c  uc cauauacggg accuga gua cac  c
   -----a  c gu  a          c      c   c   ga 
Get sequence
Deep sequencing
26253 reads, 70.2 reads per million, 104 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 63256851-63256932 [+]
sense
OTTMUST00000054416 ; Col27a1-004; intron 7
OTTMUST00000000702 ; Col27a1-002; intron 10
OTTMUST00000054415 ; Col27a1-003; intron 10
OTTMUST00000000701 ; Col27a1-001; intron 10
ENSMUST00000184067 ; Col27a1-004; intron 7
ENSMUST00000125504 ; Col27a1-002; intron 10
ENSMUST00000148751 ; Col27a1-003; intron 10
ENSMUST00000036300 ; Col27a1-001; intron 10
Database links

Mature sequence mmu-miR-455-5p

Accession MIMAT0003485
Previous IDsmmu-miR-455;mmu-miR-455-5p;mmu-miR-455*
Sequence

17 - 

uaugugccuuuggacuacaucg

 - 38

Get sequence
Deep sequencing10254 reads, 97 experiments
Evidence experimental; MPSS [1], miRAP-cloned [2], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-455-3p

Accession MIMAT0003742
Previous IDsmmu-miR-455-3p;mmu-miR-455
Sequence

54 - 

gcaguccacgggcauauacac

 - 74

Get sequence
Deep sequencing15984 reads, 101 experiments
Evidence experimental; MPSS [1], miRAP-cloned [2], cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).