![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-455 |
|||||
Accession | MI0004679 (change log) | ||||
Symbol | MGI:Mir455 | ||||
Description | Mus musculus miR-455 stem-loop | ||||
Gene family | MIPF0000129; mir-455 | ||||
Literature search |
![]()
41 open access papers mention mmu-mir-455 | ||||
Stem-loop |
cucccu u ug c u a c aa 5' gg g ag guaugugccu uggacu cau gug c || | || |||||||||| |||||| ||| ||| g 3' cu c uc cauauacggg accuga gua cac c -----a c gu a c c c ga |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-455-5p |
|
Accession | MIMAT0003485 |
Previous IDs | mmu-miR-455;mmu-miR-455-5p;mmu-miR-455* |
Sequence |
17 - uaugugccuuuggacuacaucg - 38 |
Deep sequencing | 10254 reads, 97 experiments |
Evidence | experimental; MPSS [1], miRAP-cloned [2], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-455-3p |
|
Accession | MIMAT0003742 |
Previous IDs | mmu-miR-455-3p;mmu-miR-455 |
Sequence |
54 - gcaguccacgggcauauacac - 74 |
Deep sequencing | 15984 reads, 101 experiments |
Evidence | experimental; MPSS [1], miRAP-cloned [2], cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
2 |
PMID:16973894
"Mouse microRNA profiles determined with a new and sensitive cloning method"
Nucleic Acids Res. 34:e115(2006).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|