miRBase entry: mmu-mir-669c

Stem-loop mmu-mir-669c


Accession
MI0004673
Symbol
MGI: Mir669c
Description
Mus musculus mmu-mir-669c precursor miRNA
Gene family
MIPF0000316; mir-467

Literature search
20 open access papers mention mmu-mir-669c
(43 sentences)

Sequence

240557 reads, 1454 reads per million, 107 experiments
ccuccauguaugugcauguguguAUAGUUGUGUGUGGAUGUGUGUauuugcauauaaauaacaUACACACACACACACAAGUAAAcacaagugcacaaacagacacagg
(((...(((.(((((((.(((((.((.(((((((((..((((((((((((........))).)))))))))))))))))).)).))))).))))))).))).....)))

Structure
   --cca   a       g     A  G         GA         -   cau 
ccu     ugu ugugcau ugugu UA UUGUGUGUG  UGUGUGUau uug   a
|||     ||| ||||||| ||||| || |||||||||  ||||||||| |||    
gga     aca acacgug acacA AU AACACACAC  ACACACAUa aau   u
   cacag   a       a     A  G         --         c   aaa 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr2: 10509296-10509404 [+]
Clustered miRNAs
23 other miRNAs are < 10 kb from mmu-mir-669c
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-669c-5p

Accession MIMAT0003479
Description Mus musculus mmu-miR-669c-5p mature miRNA
Sequence 24 - AUAGUUGUGUGUGGAUGUGUGU - 45
Evidence experimental
MPSS [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-669c-3p

Accession MIMAT0017253
Description Mus musculus mmu-miR-669c-3p mature miRNA
Sequence 64 - UACACACACACACACAAGUAAA - 85
Evidence experimental
Illumina [4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771