![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-669a-2 |
||||||||||||||||||||||||||||||||||||||||||||||||||
Accession | MI0004667 (change log) | |||||||||||||||||||||||||||||||||||||||||||||||||
Symbol | MGI:Mir669a-2 | |||||||||||||||||||||||||||||||||||||||||||||||||
Description | Mus musculus miR-669a-2 stem-loop | |||||||||||||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000316; mir-467 | |||||||||||||||||||||||||||||||||||||||||||||||||
Literature search |
![]()
15 open access papers mention mmu-mir-669a-2 | |||||||||||||||||||||||||||||||||||||||||||||||||
Stem-loop |
ca a a g gu c c c au 5' ugu ugugc ugugu uaua ugugugug auguu augu uau u ||| ||||| ||||| |||| |||||||| ||||| |||| ||| 3' aca acacg acgca auau acacacac uacaa uaca aua u -- c a a gc a - u ag |
|||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-669a-5p |
|
Accession | MIMAT0003477 |
Previous IDs | mmu-miR-669a |
Sequence |
22 - aguugugugugcauguucaugucu - 45 |
Deep sequencing | 946140 reads, 103 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-669a-3p |
|
Accession | MIMAT0017243 |
Sequence |
58 - acauaacauacacacacacguau - 80 |
Deep sequencing | 209132 reads, 101 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
2 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
3 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|