![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-669a-1 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession | MI0004523 (change log) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Symbol | MGI:Mir669a-1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | Mus musculus miR-669a-1 stem-loop | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000316; mir-467 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Literature search |
![]()
15 open access papers mention mmu-mir-669a-1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Stem-loop |
u -- a g gu c c c au 5' gua ugugc ugugu uaua ugugugug auguu augu uau u ||| ||||| ||||| |||| |||||||| ||||| |||| ||| 3' cau acacg acgca auau acacacac uacaa uaca aua u a ac a a gc a - u ag |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comments |
The sequence of miR-669a-1 is of low complexity. The sequence maps exactly to several genomic positions, and many more with 1 or 2 substitutions. Confidence in this miRNA might therefore be reduced. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-669a-5p |
|
Accession | MIMAT0003477 |
Previous IDs | mmu-miR-669a |
Sequence |
20 - aguugugugugcauguucaugucu - 43 |
Deep sequencing | 946140 reads, 103 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-669a-3p |
|
Accession | MIMAT0017243 |
Sequence |
56 - acauaacauacacacacacguau - 78 |
Deep sequencing | 209132 reads, 101 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
2 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
3 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|