miRBase entry: mmu-mir-670

Stem-loop mmu-mir-670


Accession
MI0004295
Symbol
MGI: Mir670
Description
Mus musculus mmu-mir-670 precursor miRNA
Gene family
MIPF0000734; mir-670

Literature search
2 open access papers mention mmu-mir-670
(2 sentences)

Sequence

567 reads, 101 reads per million, 45 experiments
gguuuggaggugggccugacAUCCCUGAGUGUAUGUGGUGAAccugaacuugcccugggUUUCCUCAUAUCCAUUCAGGAGUGUcagcugccucuucgcu
(((..((((((((..(((((((.((((((((.((((((.(((((((.........))))))).).))))).)))))))).)))))))))))))))..)))

Structure
   uu        gc       C        U     - U       aac 
ggu  ggaggugg  cugacAU CCUGAGUG AUGUG G GAAccug   u
|||  ||||||||  ||||||| |||||||| ||||| | |||||||   u
ucg  ucuccguc  gacUGUG GGACUUAC UAUAC C UUUgggu   g
   cu        --       A        C     U C       ccc 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr2: 94261300-94261399 [-]

Database links

Mature mmu-miR-670-5p

Accession MIMAT0003736
Description Mus musculus mmu-miR-670-5p mature miRNA
Sequence 21 - AUCCCUGAGUGUAUGUGGUGAA - 42
Evidence experimental
MPSS [1], RAKE [2], Illumina [3,5]
Database links
Predicted targets

Mature mmu-miR-670-3p

Accession MIMAT0017242
Description Mus musculus mmu-miR-670-3p mature miRNA
Sequence 60 - UUUCCUCAUAUCCAUUCAGGAGUGU - 84
Evidence experimental
454 [4], Illumina [5]
Database links
Predicted targets

References

  1. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  2. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  3. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275

  4. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771

  5. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298