![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-665 |
||||||||||||||||||||||||||||||
Accession | MI0004171 (change log) | |||||||||||||||||||||||||||||
Symbol | MGI:Mir665 | |||||||||||||||||||||||||||||
Description | Mus musculus miR-665 stem-loop | |||||||||||||||||||||||||||||
Gene family | MIPF0000404; mir-665 | |||||||||||||||||||||||||||||
Literature search |
![]()
10 open access papers mention mmu-mir-665 | |||||||||||||||||||||||||||||
Stem-loop |
--agaaca u - u aucca a u 5' ggguc ccu ugaggggccuc gccucu gg uuaug u ||||| ||| ||||||||||| |||||| || ||||| 3' uccgg gga auucccuggag cggagg cc aguau u ucucauuc c c u ----a - u |
|||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
|||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-665-5p |
|
Accession | MIMAT0017238 |
Previous IDs | mmu-miR-665* |
Sequence |
18 - aggggccucugccucuauccaggauu - 43 |
Deep sequencing | 232 reads, 33 experiments |
Evidence | experimental; Illumina [5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-665-3p |
|
Accession | MIMAT0003733 |
Previous IDs | mmu-miR-665 |
Sequence |
55 - accaggaggcugaggucccu - 74 |
Deep sequencing | 18249 reads, 77 experiments |
Evidence | experimental; MPSS [1], cloned [2-3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
2 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|