![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-301b |
||||||
Accession | MI0004122 (change log) | |||||
Symbol | MGI:Mir301b | |||||
Description | Mus musculus miR-301b stem-loop | |||||
Gene family | MIPF0000034; mir-130 | |||||
Literature search |
![]()
24 open access papers mention mmu-mir-301b | |||||
Stem-loop |
u -cu c g c uagguugc c ug g 5' uuc gcugg u cgggugcu ugac acua ug cugu a ||| ||||| | |||||||| |||| |||| || |||| g 3' aag cgacc g gucuacga acug uggu ac gacg a g cuc a g a -----uua a gu a |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-301b-5p |
|
Accession | MIMAT0017232 |
Previous IDs | mmu-miR-301b* |
Sequence |
20 - gcucugacuagguugcacuacu - 41 |
Deep sequencing | 261 reads, 35 experiments |
Evidence | experimental; Illumina [5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-301b-3p |
|
Accession | MIMAT0004186 |
Previous IDs | mmu-miR-301b |
Sequence |
55 - cagugcaaugguauugucaaagc - 77 |
Deep sequencing | 161490 reads, 108 experiments |
Evidence | experimental; miRAP-cloned [1], cloned [2], 454 [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16973894
"Mouse microRNA profiles determined with a new and sensitive cloning method"
Nucleic Acids Res. 34:e115(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:17989215
"RNA sequence analysis defines Dicer's role in mouse embryonic stem cells"
Proc Natl Acad Sci U S A. 104:18097-18102(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|