![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-1224 |
|||||
Accession | MI0004118 (change log) | ||||
Symbol | MGI:Mir1224 | ||||
Description | Mus musculus miR-1224 stem-loop | ||||
Gene family | MIPF0000440; mir-1224 | ||||
Literature search |
![]()
22 open access papers mention mmu-mir-1224 | ||||
Stem-loop |
g cu ------ u aucau c 5' ugagga ggggaggugg aggg agc uagagc a |||||| |||||||||| |||| ||| |||||| 3' acuccu cuucuccacc uccc ucg gucucg g g cu ccccuc - acucu a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by more extensive cloning [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-1224-5p |
|
Accession | MIMAT0005460 |
Previous IDs | mmu-miR-1224 |
Sequence |
1 - gugaggacuggggagguggag - 21 |
Deep sequencing | 33804 reads, 58 experiments |
Evidence | experimental; RAKE [1], cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-1224-3p |
|
Accession | MIMAT0017231 |
Previous IDs | mmu-miR-1224* |
Sequence |
65 - ccccaccucuucucuccucag - 85 |
Deep sequencing | 49 reads, 16 experiments |
Evidence | experimental; Illumina [4] |
Predicted targets |
|
References |
|
1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
2 |
PMID:17964270
"Mammalian mirtron genes"
Mol Cell. 28:328-336(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|