Stem-loop sequence hsa-mir-671

Accession

MI0003760 (change log)

Symbol

HGNC:MIR671

Description

Homo sapiens miR-671 stem-loop

Gene family

MIPF0000358; mir-671

Literature search

40 open access papers mention hsa-mir-671
(289 sentences)

Stem-loop

      ggu aa     ----a    a        a   a      ga           -u   g 
5' gca   g  cuggc     ggcc ggaagagg gga gcccug  ggggcuggagg  gau g
   |||   |  |||||     |||| |||||||| ||| ||||||  |||||||||||  |||  
3' cgu   c  gaccg     ccgg cuuucucc ccu cgggac  ucuuggccucc  uug a
      ggu gg     agaug    g        a   -      --           uu   u 

Deep sequencing

33767 reads, 77.1 reads per million, 153 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr7: 151238421-151238538 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR671
• HGNC:MIR671
• RNAcentral:URS000075DC96_9606
• miRBase Tracker:MI0003760

Mature sequence hsa-miR-671-5p

• Accession: MIMAT0003880
• Previous IDs: hsa-miR-671
• Sequence: 29 - aggaagcccuggaggggcuggag - 51
• Deep sequencing: 30212 reads, 147 experiments
• Evidence: experimental; cloned [1-2]
• Database links:
  • RNAcentral:URS00002FB368_9606
• Predicted targets:
  • TargetMiner:hsa-miR-671-5p
  • TargetScanVert:hsa-miR-671-5p
  • miRDB:hsa-miR-671-5p
  • microrna.org:hsa-miR-671-5p

Mature sequence hsa-miR-671-3p

• Accession: MIMAT0004819
• Sequence: 68 - uccgguucucagggcuccacc - 88
• Deep sequencing: 3365 reads, 148 experiments
• Evidence: experimental; cloned [2]
• Database links:
  • RNAcentral:URS00002B7450_9606
• Predicted targets:
  • TargetMiner:hsa-miR-671-3p
  • TargetScanVert:hsa-miR-671-3p
  • miRDB:hsa-miR-671-3p
  • microrna.org:hsa-miR-671-3p

References

1. PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).