Stem-loop ebv-mir-BART12

Accession

MI0003734

Description

Epstein Barr virus ebv-mir-BART12 precursor miRNA

Gene family

MIPF0000335; mir-BART12

Sequence

cuggugaccuaacacccgcccaucaccaccggacagauucugaacuugUCCUGUGGUGUUUGGUGUGGUUuugggguacgcag
(((((..(((((.(((((((...((((((.((((((.........)))))).))))))...)))).))).)))))..)).)))

Structure

   -  ga     c   -    cau      c      auu 
cug gu  ccuaa acc cgcc   caccac ggacag   c
||| ||  ||||| ||| ||||   |||||| ||||||   u
gac ca  ggguu UGG GUGG   GUGGUG CCUguu   g
   g  ug     U   U    UUU      U      caa 

Annotation confidence Not enough data

Comments

mir-BART12 was discovered independently by two groups. Cai et al mapped the ends of the mature sequence by cloning [1]. Grundhoff et al confirmed that the 3' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. This sequence is misnamed miR-BART16 in [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

HHV507799: 147888-147970 [+]

Clustered miRNAs

21 other miRNAs are < 10 kb from ebv-mir-BART12

Disease association

ebv-mir-BART12 is associated with one or more human diseases in the Human microRNA Disease Database

Mature ebv-miR-BART12

• Accession: MIMAT0003423
• Description: Epstein Barr virus ebv-miR-BART12 mature miRNA
• Sequence: 49 - UCCUGUGGUGUUUGGUGUGGUU - 70
• Evidence: experimental ; cloned [1,3], array [2], Northern [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16557291
   Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed
   Cai X, Schäfer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR
   PLoS Pathog (2006) 2:e23


3. PubMed ID: 16540699
   A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses
   "Grundhoff A, Sullivan CS, Ganem D"
   "RNA (2006) 12:733-750