![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-664-1 |
|||||
Accession | MI0003722 (change log) | ||||
Description | Rattus norvegicus miR-664-1 stem-loop | ||||
Gene family | MIPF0000300; mir-664 | ||||
Literature search |
![]()
5 open access papers mention rno-mir-664-1 | ||||
Stem-loop |
cu aaaa u aa 5' ggcugggga ga uggauagaa c ||||||||| || ||||||||| a 3' ccgaccccu uu acuuaucuu u au --ca u au |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-664-1-5p |
|
Accession | MIMAT0017228 |
Previous IDs | rno-miR-664-1* |
Sequence |
1 - cuggcuggggaaaaagauugg - 21 |
Deep sequencing | 8130 reads, 421 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
Mature sequence rno-miR-664-3p |
|
Accession | MIMAT0003382 |
Previous IDs | rno-miR-664 |
Sequence |
38 - uauucauuuacuccccagccua - 59 |
Deep sequencing | 77272 reads, 473 experiments |
Evidence | experimental; cloned [1], Northern [1], SOLiD [2] |
Predicted targets |
|
References |
|
1 | |
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|