miRBase entry: mmu-mir-302b

Stem-loop mmu-mir-302b


Accession
MI0003716
Symbol
MGI: Mir302b
Description
Mus musculus mmu-mir-302b precursor miRNA
Gene family
MIPF0000071; mir-302

Literature search
81 open access papers mention mmu-mir-302b
(634 sentences)

Sequence

1683 reads, 110 reads per million, 20 experiments
guucccuucaACUUUAACAUGGGAAUGCUUUCUgucucaucgaagagUAAGUGCUUCCAUGUUUUAGUAGaagu
.....((((.(((..(((((((((..((...((..(((......)))..)).)))))))))))..))).)))).

Structure
guucc    a   UU         AU  UUU  gu   au 
     cuuc ACU  AACAUGGGA  GC   CU  cuc  c
     |||| |||  |||||||||  ||   ||  |||   
     gaaG UGA  UUGUACCUU  CG   GA  gag  g
----u    A   UU         --  --U  AU   aa 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
Mouse miR-302b was verified experimentally by Mineno et al using MPSS technology [1]. The MPSS protocol used provides 22nt sequences, but the true extents of the mature miRNA are not reliably obtained. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr3: 127545228-127545301 [+]
Clustered miRNAs
4 other miRNAs are < 10 kb from mmu-mir-302b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-302b-5p

Accession MIMAT0003373
Description Mus musculus mmu-miR-302b-5p mature miRNA
Sequence 11 - ACUUUAACAUGGGAAUGCUUUCU - 33
Evidence experimental
Illumina [3-4]

Mature mmu-miR-302b-3p

Accession MIMAT0003374
Description Mus musculus mmu-miR-302b-3p mature miRNA
Sequence 48 - UAAGUGCUUCCAUGUUUUAGUAG - 70
Evidence experimental
MPSS [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771