Stem-loop sequence hcmv-mir-UL70

AccessionMI0003688 (change log)
DescriptionHuman cytomegalovirus miR-UL70 stem-loop
Stem-loop
           c      u     -aga  -    a 
5' gguugcgu ucggcc cgucc    cu ggcg u
   |||||||| |||||| |||||    || |||| g
3' ccggcgcg ggucgg guagg    ga ccgc a
           c      -     ggga  g    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:X17403.1) Overlapping transcripts
HEHCMVCG: 103087-103152 [+]
intergenic
Clustered miRNAs
< 10kb from hcmv-mir-UL70
hcmv-mir-UL59HEHCMVCG: 94602-94667 [+]
hcmv-mir-UL69HEHCMVCG: 96898-96964 [+]
hcmv-mir-UL70HEHCMVCG: 103087-103152 [+]
Database links

Mature sequence hcmv-miR-UL70-5p

Accession MIMAT0003342
Sequence

4 - 

ugcgucucggccucguccaga

 - 24

Get sequence
Evidence experimental; Northern [1], Illumina [2]

Mature sequence hcmv-miR-UL70-3p

Accession MIMAT0003343
Sequence

45 - 

ggggaugggcuggcgcgcgg

 - 64

Get sequence
Evidence experimental; Northern [1], Illumina [2]

References

1
PMID:16140786 "Identification and characterization of human cytomegalovirus-encoded microRNAs" Grey F, Antoniewicz A, Allen E, Saugstad J, McShea A, Carrington JC, Nelson J J Virol. 79:12095-12099(2005).
2
PMID:22715351 "The microRNA Transcriptome of Human Cytomegalovirus (HCMV)" Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS Open Virol J. 6:38-48(2012).