miRBase entry: hsa-mir-656

Stem-loop hsa-mir-656


Accession
MI0003678
Symbol
HGNC: MIR656
Description
Homo sapiens hsa-mir-656 precursor miRNA
Gene family
MIPF0000018; mir-154

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR656 is a microRNA that has been implicated in various biological processes and diseases. It has been found to be associated with sensitivity to KIN001-236 in ovarian cell lines and bleomycin in renal cell carcinoma cell lines [PMC9716673]. Additionally, MIR656 has been identified as a potential gene associated with the progression of severe pneumonia [PMC6090384]. It is worth noting that MIR656, along with EIF5AP4, are novel genes that have not yet been reported to be related to pneumonia [PMC6090384]. MIR656 has also been identified as a gene that shows a significantly lower methylation rate in invasive adenocarcinoma relative to AIS [PMC6422190]. In the context of multiple sclerosis, MIR656 is one of the miRNAs that seem to be less expressed in the diseased context [PMC4655260]. Furthermore, MIR656 has shown decreased expression levels in certain brain regions compared to others [PMC7848201]. Overall, these findings suggest that MIR656 may play important roles in various biological processes and diseases.

Literature search
12 open access papers mention hsa-mir-656
(38 sentences)

Sequence

377 reads, 21 reads per million, 62 experiments
cugaaauAGGUUGCCUGUGAGGUGUUCAcuuucuauaugaugAAUAUUAUACAGUCAACCUCUuuccgauaucgaauc
..((((.((((((.(((((.((((((((...((.....)))))))))).))))).)))))).))))............

Structure
----------cu    u      C     A        cuu  u 
            gaaa AGGUUG CUGUG GGUGUUCA   uc a
            |||| |||||| ||||| ||||||||   || u
            cuuU UCCAAC GACAU UUAUAAgu   ag a
cuaagcuauagc    C      U     A        ---  u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101066724-101066801 [+]
Clustered miRNAs
8 other miRNAs are < 10 kb from hsa-mir-656
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-656 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-656-3p

Accession MIMAT0003332
Description Homo sapiens hsa-miR-656-3p mature miRNA
Sequence 43 - AAUAUUAUACAGUCAACCUCU - 63
Evidence experimental
Microarray [1], RT-PCR [1], SAGE [1], Illumina [2]
Database links
Predicted targets

Mature hsa-miR-656-5p

Accession MIMAT0026627
Description Homo sapiens hsa-miR-656-5p mature miRNA
Sequence 8 - AGGUUGCCUGUGAGGUGUUCA - 28
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692

  2. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45