![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-33b |
||||||
Accession | MI0003646 (change log) | |||||
Symbol | HGNC:MIR33B | |||||
Description | Homo sapiens miR-33b stem-loop | |||||
Gene family | MIPF0000070; mir-33 | |||||
Literature search |
![]()
121 open access papers mention hsa-mir-33b | |||||
Stem-loop |
----- --- - c c - uu g g 5' gc gggc ggc ccg gg ugcauugcug gcauugcac ugu u || |||| ||| ||| || |||||||||| ||||||||| ||| g 3' cg cccg ccg ggc cc acgugacggc cgugacgug gcg a cacca guc g a - g uc g g |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-33b-5p |
|
Accession | MIMAT0003301 |
Previous IDs | hsa-miR-33b |
Sequence |
16 - gugcauugcuguugcauugc - 35 |
Deep sequencing | 9770 reads, 142 experiments |
Evidence | experimental; SAGE [1], cloned [2] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-33b-3p |
|
Accession | MIMAT0004811 |
Previous IDs | hsa-miR-33b* |
Sequence |
54 - cagugccucggcagugcagccc - 75 |
Deep sequencing | 1236 reads, 88 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16505370
"The colorectal microRNAome"
Proc Natl Acad Sci U S A. 103:3687-3692(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|