![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-579 |
|||||
Accession | MI0003586 (change log) | ||||
Symbol | HGNC:MIR579 | ||||
Description | Homo sapiens miR-579 stem-loop | ||||
Gene family | MIPF0000317; mir-548 | ||||
Literature search |
![]()
16 open access papers mention hsa-mir-579 | ||||
Stem-loop |
cauauuag a cg aa 5' guu augcaaaaguaaucgcgguuugugccagauga auuug u ||| |||||||||||||||||||||||||||||||| ||||| 3' caa uacguuuuuauuagcgccaaauaugguuuacu uaaau u -------- c -- aa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-579-5p |
|
Accession | MIMAT0026616 |
Sequence |
25 - ucgcgguuugugccagaugacg - 46 |
Deep sequencing | 3239 reads, 113 experiments |
Evidence | experimental; Illumina [3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-579-3p |
|
Accession | MIMAT0003244 |
Sequence |
62 - uucauuugguauaaaccgcgauu - 84 |
Deep sequencing | 1220 reads, 104 experiments |
Evidence | experimental; SAGE [1], cloned [2], Illumina [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16505370
"The colorectal microRNAome"
Proc Natl Acad Sci U S A. 103:3687-3692(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|