miRBase entry: hsa-mir-579

Stem-loop hsa-mir-579


Accession
MI0003586
Symbol
HGNC: MIR579
Description
Homo sapiens hsa-mir-579 precursor miRNA
Gene family
MIPF0000317; mir-548

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR579 is a microRNA that has been implicated in various biological processes and diseases. In patients with bevacizumab-induced cardiotoxicity, the expression of MIR579 was found to be specifically elevated, along with miR1254, and miR1254 showed the strongest association with the clinical diagnosis of cardiotoxicity [PMC7578723]. When an artificial CNNC motif was engineered in MIR579, there was no increase in processing [PMC5340965]. However, a combination of CNNC and stem length reduction resulted in a stronger increase in processing relative to the wild-type construct [PMC5340965]. MIR579 does not contain a CNNC motif within the enriched distances [PMC5340965]. Inhibition of MIR579 leads to higher expression of Ang-1, occludin, and SIRT1 [PMC9563036]. The cPWWP2A protein alleviates diabetes mellitus-induced retinal vascular dysfunction by inhibiting MIR579 activity [PMC9563036]. The minor (T)-allele of rs2910931 upstream of MIR579 leads to increased expression of hsa-miR-579-3p and more effective repression of SLC6A2 expression along with higher synaptic noradrenaline levels in vivo resulting in higher trait anxiety in healthy individuals possibly due to increased activation of midbrain and limbic areas during fear processing. This allele is also associated with Parkinson's disease mediated by increased sympathetic noradrenergic arousal when entering contexts of potential threat [PMC6195525]. Conservation analysis has shown that MIR579 is only conserved among certain primate species and its seed sequence is incompletely conserved in more distantly related species such as mice or rats. The regulation and function of MIR579 are still not fully understood [PMC6195525].

Literature search
16 open access papers mention hsa-mir-579
(53 sentences)

Sequence

1159 reads, 98 reads per million, 73 experiments
cauauuagguuaaugcaaaaguaaUCGCGGUUUGUGCCAGAUGACGauuugaauuaauaaaUUCAUUUGGUAUAAACCGCGAUUauuuuugcaucaac
........(((.((((((((((((((((((((((((((((((((..(((((......))))))))))))))))))))))))))))))))))))).)))

Structure
cauauuag   a                                CG     aa 
        guu augcaaaaguaaUCGCGGUUUGUGCCAGAUGA  auuug  u
        ||| ||||||||||||||||||||||||||||||||  |||||   
        caa uacguuuuuaUUAGCGCCAAAUAUGGUUUACU  Uaaau  u
--------   c                                --     aa 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr5: 32394378-32394475 [-]

Disease association
hsa-mir-579 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-579-3p

Accession MIMAT0003244
Description Homo sapiens hsa-miR-579-3p mature miRNA
Sequence 62 - UUCAUUUGGUAUAAACCGCGAUU - 84
Evidence experimental
SAGE [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-579-5p

Accession MIMAT0026616
Description Homo sapiens hsa-miR-579-5p mature miRNA
Sequence 25 - UCGCGGUUUGUGCCAGAUGACG - 46
Evidence experimental
Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45