Stem-loop sequence hsa-mir-570

Accession

MI0003577 (change log)

Symbol

HGNC:MIR570

Description

Homo sapiens miR-570 stem-loop

Gene family

MIPF0000317; mir-548

Literature search

17 open access papers mention hsa-mir-570
(79 sentences)

Stem-loop

   cuagauaag         g                 a      c c      
5'          uuauuaggu ggugcaaagguaauugc guuuuu c auuau 
            ||||||||| ||||||||||||||||| |||||| | |||| u
3'          gguagucca ccacguuuccauuaacg caaaag g uaauu 
   ------uga         a                 a      c u      

Deep sequencing

3809 reads, 4.65 reads per million, 129 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr3: 195699401-195699497 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000341371 ; SDHAP1-006; intron 2

  OTTHUMT00000341367 ; SDHAP1-002; intron 10

  OTTHUMT00000341366 ; SDHAP1-001; intron 10

  ENST00000457601 ; SDHAP1-006; intron 2

  ENST00000427841 ; SDHAP1-002; intron 10

  ENST00000440850 ; SDHAP1-001; intron 10

  ENST00000354937 ; SDHAP1-201; intron 11

Database links

• EntrezGene:MIR570
• HGNC:MIR570
• RNAcentral:URS0000759B29_9606
• miRBase Tracker:MI0003577

Mature sequence hsa-miR-570-5p

• Accession: MIMAT0022707
• Sequence: 25 - aaagguaauugcaguuuuuccc - 46
• Deep sequencing: 1187 reads, 101 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS000031D186_9606
• Predicted targets:
  • TargetMiner:hsa-miR-570-5p
  • TargetScanVert:hsa-miR-570-5p
  • miRDB:hsa-miR-570-5p

Mature sequence hsa-miR-570-3p

• Accession: MIMAT0003235
• Previous IDs: hsa-miR-570
• Sequence: 60 - cgaaaacagcaauuaccuuugc - 81
• Deep sequencing: 2576 reads, 120 experiments
• Evidence: experimental; SAGE [1], cloned [2]
• Database links:
  • RNAcentral:URS0000250A40_9606
• Predicted targets:
  • TargetMiner:hsa-miR-570-3p
  • TargetScanVert:hsa-miR-570-3p
  • miRDB:hsa-miR-570-3p
  • microrna.org:hsa-miR-570-3p

References

1. PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).