miRBase entry: hsa-mir-92b

Stem-loop hsa-mir-92b


Accession
MI0003560
Symbol
HGNC: MIR92B
Description
Homo sapiens hsa-mir-92b precursor miRNA
Gene family
MIPF0000013; mir-25

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR92B is a microRNA that has been implicated in various biological processes, including inflammatory response, autophagy, and neuronal development. It has been shown to down-regulate TRAF3 and suppress the MKK3-p38 pathway in acute pancreatitis inflammatory disease [PMC9960688]. MIR92B is predicted to reside within the Cia10 interval on rat chromosome 2 [PMC3339715]. It has been found to negatively modulate the expression of EZH2, a histone-lysine N-methyltransferase that can influence autophagy [PMC8000899]. MIR92B has also been implicated in the development of intermediate cortical progenitors in the embryonic mouse brain [PMC5764268]. In addition, MIR92B has been shown to be involved in heart development and overall body patterning in zebrafish embryos [PMC9837005]. In cancer research, MIR92B expression has been found to be dysregulated in various malignancies and is associated with prognosis [PMC3569899] [PMC6368411]. Furthermore, MIR92B expression is inversely correlated with EZH2 expression in breast cancer cells and can influence autophagy processes [PMC6952790]. In PCOS (polycystic ovary syndrome), differential expression of miR-92a and MIR92B has been observed in the ovary [PMC7199502]. Overall, MIR92B plays a crucial role in various biological processes and may have potential implications for disease development.

Literature search
201 open access papers mention hsa-mir-92b
(623 sentences)

Sequence

93988 reads, 954 reads per million, 128 experiments
cgggccccgggcgggcgggAGGGACGGGACGCGGUGCAGUGuuguuuuuucccccgccaaUAUUGCACUCGUCCCGGCCUCCggcccccccggccc
.(((((..(((.((((.(((((..(((((((.((((((((((((.............))))))))))))))))))).))))).))))))).)))))

Structure
c     cc   c    g     GA       C            uuuuu 
 gggcc  ggg gggc ggAGG  CGGGACG GGUGCAGUGuug     u
 |||||  ||| |||| |||||  ||||||| ||||||||||||     c
 cccgg  ccc cccg CCUCC  GCCCUGC UCACGUUAUaac     c
-     -c   -    g     -G       -            cgccc 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr1: 155195177-155195272 [+]

Disease association
hsa-mir-92b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-92b is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-92b is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-92b-5p

Accession MIMAT0004792
Description Homo sapiens hsa-miR-92b-5p mature miRNA
Sequence 20 - AGGGACGGGACGCGGUGCAGUG - 41
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-92b-3p

Accession MIMAT0003218
Description Homo sapiens hsa-miR-92b-3p mature miRNA
Sequence 61 - UAUUGCACUCGUCCCGGCCUCC - 82
Evidence experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692