miRBase entry: mmu-mir-494

Stem-loop mmu-mir-494


Accession
MI0003532
Symbol
MGI: Mir494
Description
Mus musculus mmu-mir-494 precursor miRNA
Gene family
MIPF0000018; mir-154

Literature search
67 open access papers mention mmu-mir-494
(740 sentences)

Sequence

15792 reads, 468 reads per million, 83 experiments
uugauacuugaaggagAGGUUGUCCGUGUUGUCUUCUCuuuauuuaugaUGAAACAUACACGGGAAACCUCuuuuuuaguaucaa
.(((((((.((((((((((((.((((((((((.(((((.........)).)))))).))))))).))))))))))))))))))).

Structure
u       u            G       -   C   -  uuu 
 ugauacu gaaggagAGGUU UCCGUGU UGU UUC UC   a
 ||||||| |||||||||||| ||||||| ||| ||| ||   u
 acuauga uuuuuuCUCCAA GGGCACA ACA AAG ag   u
a       -            A       U   -   U  uau 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr12: 109715318-109715402 [+]
Clustered miRNAs
20 other miRNAs are < 10 kb from mmu-mir-494
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-494-5p

Accession MIMAT0017215
Description Mus musculus mmu-miR-494-5p mature miRNA
Sequence 17 - AGGUUGUCCGUGUUGUCUUCUC - 38
Evidence experimental
Illumina [5]
Database links
Predicted targets

Mature mmu-miR-494-3p

Accession MIMAT0003182
Description Mus musculus mmu-miR-494-3p mature miRNA
Sequence 50 - UGAAACAUACACGGGAAACCUC - 71
Evidence experimental
cloned [1,3], MPSS [2], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771

  5. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267