![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-539 |
||||||||||||||||||||||||||||||||||||||
Accession | MI0003526 (change log) | |||||||||||||||||||||||||||||||||||||
Description | Rattus norvegicus miR-539 stem-loop | |||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||||||||||||||
Literature search |
![]()
5 open access papers mention rno-mir-539 | |||||||||||||||||||||||||||||||||||||
Stem-loop |
g - cu u 5' auacuugaggagaaauuauccuug ugug uuug c u |||||||||||||||||||||||| |||| |||| | 3' uaugagcuuuucuuuaaugggaac auac aagu g u - u ag u |
|||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||
Database links |
Mature sequence rno-miR-539-5p |
|
Accession | MIMAT0003176 |
Previous IDs | rno-miR-539 |
Sequence |
9 - ggagaaauuauccuuggugugu - 30 |
Deep sequencing | 11374 reads, 260 experiments |
Evidence | experimental; cloned [2], SOLiD [3] |
Predicted targets |
|
Mature sequence rno-miR-539-3p |
|
Accession | MIMAT0017212 |
Previous IDs | rno-miR-539* |
Sequence |
49 - cauacaaggguaauuucuuuuc - 70 |
Deep sequencing | 5124 reads, 230 experiments |
Evidence | experimental; SOLiD [3] |
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|