![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-543 |
||||||||||||||||||||||||||||||||||||||||||||||
Accession | MI0003525 (change log) | |||||||||||||||||||||||||||||||||||||||||||||
Description | Rattus norvegicus miR-543 stem-loop | |||||||||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000110; mir-329 | |||||||||||||||||||||||||||||||||||||||||||||
Literature search |
![]()
4 open access papers mention rno-mir-543 | |||||||||||||||||||||||||||||||||||||||||||||
Stem-loop |
u u u - -- - uu 5' ggugcu aa gagaagu gc ccgcg uguuuu ucgc u |||||| || ||||||| || ||||| |||||| |||| a 3' cuacga uu uucuuca cg ggcgc acaaag agug u c u - u uu c ua |
|||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||||
Database links |
Mature sequence rno-miR-543-5p |
|
Accession | MIMAT0004787 |
Previous IDs | rno-miR-543 |
Sequence |
14 - aaguugcccgcguguuuuucg - 34 |
Deep sequencing | 1908 reads, 161 experiments |
Evidence | experimental; cloned [2], SOLiD [3] |
Predicted targets |
|
Mature sequence rno-miR-543-3p |
|
Accession | MIMAT0003175 |
Previous IDs | rno-miR-543;rno-miR-543* |
Sequence |
49 - aaacauucgcggugcacuucu - 69 |
Deep sequencing | 16000 reads, 285 experiments |
Evidence | experimental; SOLiD [3] |
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|