![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-543 |
||||||||||||||||||||||||||||||||||||||||||||||
Accession | MI0003519 (change log) | |||||||||||||||||||||||||||||||||||||||||||||
Symbol | MGI:Mir543 | |||||||||||||||||||||||||||||||||||||||||||||
Description | Mus musculus miR-543 stem-loop | |||||||||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000110; mir-329 | |||||||||||||||||||||||||||||||||||||||||||||
Literature search |
![]()
15 open access papers mention mmu-mir-543 | |||||||||||||||||||||||||||||||||||||||||||||
Stem-loop |
u u u u - -- - uu 5' gcu aa gagaagu gc ccgcg uguuuu ucgc u ||| || ||||||| || ||||| |||||| |||| a 3' cga uu uucuuca cg ggcgc acaaag agug u a c u - u uu c ua |
|||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||||||||||||||||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
|||||||||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-543-5p |
|
Accession | MIMAT0017207 |
Previous IDs | mmu-miR-543* |
Sequence |
12 - aaguugcccgcguguuuuucg - 32 |
Deep sequencing | 1649 reads, 51 experiments |
Evidence | experimental; 454 [6], Illumina [7] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-543-3p |
|
Accession | MIMAT0003168 |
Previous IDs | mmu-miR-543 |
Sequence |
47 - aaacauucgcggugcacuucuu - 68 |
Deep sequencing | 23103 reads, 82 experiments |
Evidence | experimental; cloned [1,4], MPSS [2], miRAP-cloned [3], Illumina [5,7] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
3 |
PMID:16973894
"Mouse microRNA profiles determined with a new and sensitive cloning method"
Nucleic Acids Res. 34:e115(2006).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
7 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|