Stem-loop sequence ppt-MIR537b

AccessionMI0003509 (change log)
DescriptionPhyscomitrella patens miR537b stem-loop
Gene family MIPF0000207; MIR537
Literature search

1 open access papers mention ppt-MIR537b
(1 sentences)

Stem-loop
         c   a              g   u ac       a  -       ----aggua  a     a      c 
5' ucauau ugg cuguagaaacaccu aag g  ugaaguu gu ccgguuu         ug gaaug uuggag a
   |||||| ||| |||||||||||||| ||| |  ||||||| || |||||||         || ||||| |||||| c
3' aguaua auc gacaucuuugugga uuc c  acuucga cg ggccaaa         ac cuugu gaccuc c
         c   g              g   u ga       a  u       guaauguag  -     a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr03: 2354702-2354850 [+]
intergenic
Database links

Mature sequence ppt-miR537b

Accession MIMAT0003146
Sequence

122 - 

uugagguguuucuacaggcua

 - 142

Get sequence
Evidence experimental; cloned [1], 454 [2]

References

1
PMID:16146523 "Cloning and characterization of micro-RNAs from moss" Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC Plant J. 43:837-848(2005).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).