Stem-loop sequence ppt-MIR536a

AccessionMI0003507 (change log)
Previous IDsppt-MIR536
DescriptionPhyscomitrella patens miR536a stem-loop
Literature search

2 open access papers mention ppt-MIR536a
(16 sentences)

Stem-loop
      uu      cuu  a   -   u         -        ua     aauuucau      uuuc    uuagucgau      -     ------  c     -u     
5' uga  ccaccc   gg ugu cac gcuuggcac aauccucu  uugug        guccuc    gugg         agaguu guacu      ac uuuau  cauc 
   |||  ||||||   || ||| ||| ||||||||| ||||||||  |||||        ||||||    ||||         |||||| |||||      || |||||  ||| c
3' auu  gguggg   cc acg gug cgaaccgug uuggggga  aacac        uagggg    cacu         ucucga cguga      ug aaaua  guga 
      uu      aau  a   u   u         c        -c     ------gu      --uu    ---------      u     ccuguu  u     uu     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr12: 5501130-5501328 [-]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR536a
ppt-MIR536aChr12: 5501130-5501328 [-]
ppt-MIR1051Chr12: 5498625-5498821 [+]
ppt-MIR536fChr12: 5496564-5496739 [+]
Database links

Mature sequence ppt-miR536a

Accession MIMAT0003144
Previous IDsppt-miR536
Sequence

163 - 

uucgugccaagcugugugcaac

 - 184

Get sequence
Evidence experimental; cloned [1-2], 454 [3]

References

1
PMID:16146523 "Cloning and characterization of micro-RNAs from moss" Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC Plant J. 43:837-848(2005).
2
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
3
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).