Stem-loop sequence ppt-MIR156a

AccessionMI0003506 (change log)
DescriptionPhyscomitrella patens miR156a stem-loop
Gene family MIPF0000008; MIR156
Literature search

5 open access papers mention ppt-MIR156a
(10 sentences)

Stem-loop
       gu      u u  ga       -               gc  a   u    aug 
5' ggcg  ggagga g gg  gugacag aagagagugagcaca  ug gca guac   a
   ||||  |||||| | ||  ||||||| |||||||||||||||  || ||| ||||    
3' ucgc  uuuccu c cc  cgcuguc uucucucacucgugu  ac cgu caug   g
       ag      - u  -a       c               gu  c   u    aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr22: 4117123-4117237 [+]
intergenic
Database links

Mature sequence ppt-miR156a

Accession MIMAT0003143
Sequence

21 - 

ugacagaagagagugagcac

 - 40

Get sequence
Evidence experimental; cloned [1-2], 454 [3]

References

1
PMID:16146523 "Cloning and characterization of micro-RNAs from moss" Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC Plant J. 43:837-848(2005).
2
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
3
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).