Stem-loop sequence ppt-MIR535c

AccessionMI0003504 (change log)
DescriptionPhyscomitrella patens miR535c stem-loop
Gene family MIPF0000136; MIR535
Literature search

2 open access papers mention ppt-MIR535c
(3 sentences)

Stem-loop
            a     a      u       u    c  a 
5' gugacaacg gagag gcacgc ggaaugc uuca gc a
   ||||||||| ||||| |||||| ||||||| |||| || u
3' cgcuguugc cuuuc cgugcg ucuugug aggu cg a
            c     c      u       u    c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr24: 12589745-12589825 [-]
intergenic
Database links

Mature sequence ppt-miR535c

Accession MIMAT0003141
Sequence

2 - 

ugacaacgagagagagcacgc

 - 22

Get sequence
Evidence experimental; cloned [1-2], 454 [3]

References

1
PMID:16146523 "Cloning and characterization of micro-RNAs from moss" Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC Plant J. 43:837-848(2005).
2
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
3
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).