Stem-loop ppt-MIR319a

Accession

MI0003496

Description

Physcomitrella patens ppt-MIR319a precursor miRNA

Gene family

MIPF0000010; MIR159

Literature search

5 open access papers mention ppt-MIR319a
(23 sentences)

Sequence

guggagcuccguuucgguccaauaguggcugcgacggaagguggucccgcugccgaaucacacguccggguugcuuaucggggcagggccccgauacgguauccgaacguuugucccgggaacuggucgaccuuccgcccggcgucuCUUGGACUGAAGGGAGCUCCac
((((((((((.(((((((((((.((..((((.(.((((((((.(.((.(.(.(((...((.((((.(((((.((((((((((((...))))))))).)))))))).)))).))...))).).).)).).))))))))).))))..)).)))))))))))))))))))))

Structure

          g           u  ug    c a        g u  c c g   aau  c    c     u   -         a 
guggagcucc uuucgguccaa ag  gcug g cggaaggu g cc g u ccg   ca acgu cgggu gcu uaucggggc  
|||||||||| ||||||||||| ||  |||| | |||||||| | || | | |||   || |||| ||||| ||| ||||||||| g
caCCUCGAGG GAAGUCAGGUU uc  cggc c gccuucca c gg c a ggc   gu ugca gccua ugg auagccccg  
          -           C  ug    c -        g u  u a g   ccu  u    a     -   c         g 

Annotation confidence Not enough data

Genome context

Chr18: 5641294-5641462 [+]

Mature ppt-miR319a

• Accession: MIMAT0003133
• Description: Physcomitrella patens ppt-miR319a mature miRNA
• Sequence: 148 - CUUGGACUGAAGGGAGCUCC - 167
• Evidence: experimental ; cloned [1], 454 [3]

References

1. PubMed ID: 16146523
   Cloning and characterization of micro-RNAs from moss
   "Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC"
   "Plant J (2005) 43:837-848


2. PubMed ID: 17359535
   Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution
   Fattash I, Voss B, Reski R, Hess WR, Frank W
   BMC Plant Biol (2007) 7:13


3. PubMed ID: 17601824
   Common functions for diverse small RNAs of land plants
   "Axtell MJ, Snyder JA, Bartel DP"
   "Plant Cell (2007) 19:1750-1769