![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-370 |
||||||||
Accession | MI0003486 (change log) | |||||||
Description | Rattus norvegicus miR-370 stem-loop | |||||||
Gene family | MIPF0000167; mir-370 | |||||||
Literature search |
![]()
14 open access papers mention rno-mir-370 | |||||||
Stem-loop |
g ca gu u u a g 5' agacaga agaccaggu c cuc gcag uac ca c ||||||| ||||||||| | ||| |||| ||| || u 3' ucugucu uuuggucca g ggg cguc gug gu c g ag ug u c a a |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
Mature sequence rno-miR-370-5p |
|
Accession | MIMAT0017202 |
Previous IDs | rno-miR-370* |
Sequence |
13 - caggucacgucucugcaguuacac - 36 |
Deep sequencing | 2637 reads, 154 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
Mature sequence rno-miR-370-3p |
|
Accession | MIMAT0003122 |
Previous IDs | rno-miR-370 |
Sequence |
48 - gccugcugggguggaaccuggu - 69 |
Deep sequencing | 6091 reads, 240 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|