![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-501 |
||||||||||||||
Accession | MI0003480 (change log) | |||||||||||||
Description | Rattus norvegicus miR-501 stem-loop | |||||||||||||
Gene family | MIPF0000139; mir-500 | |||||||||||||
Literature search |
4 open access papers mention rno-mir-501 | |||||||||||||
Stem-loop |
cg c uc u u aaaa uau 5' gcu uc ucucuaa cuuug ccc gggug ugc u ||| || ||||||| ||||| ||| ||||| ||| u 3' cga gg agggguu ggaac ggg cccac acg g au a ua - - -gua uau |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
Mature sequence rno-miR-501-5p |
|
Accession | MIMAT0003116 |
Previous IDs | rno-miR-501 |
Sequence |
14 - aauccuuugucccuggguga - 33 |
Deep sequencing | 453 reads, 206 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
Mature sequence rno-miR-501-3p |
|
Accession | MIMAT0017198 |
Previous IDs | rno-miR-501* |
Sequence |
51 - aaugcacccgggcaaggauuugg - 73 |
Deep sequencing | 14633 reads, 470 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|