miRBase entry: mmu-mir-489

Stem-loop mmu-mir-489


Accession
MI0003476
Symbol
MGI: Mir489
Description
Mus musculus mmu-mir-489 precursor miRNA
Gene family
MIPF0000111; mir-489

Literature search
24 open access papers mention mmu-mir-489
(292 sentences)

Sequence

136 reads, 6 reads per million, 19 experiments
acugcugcaguggcagcuugguUGUCAUAUGUGUGAUGACACUUUCUaaagucuuccagAAUGACACCACAUAUAUGGCAGCuaaacuguuacauggaacaacaagu
..((.(.(((((((((.((((((((((((((((((.((.((..((((..........)))))).)).)))))))))))))))))).))))))).)).).))......

Structure
----ac  c g  -       c                  A  A  CU    aaag 
      ug u ca guggcag uugguUGUCAUAUGUGUG UG CA  UUCU    u
      || | || ||||||| |||||||||||||||||| || ||  ||||     
      ac a gu cauuguc aauCGACGGUAUAUACAC AC GU  AAga    c
ugaaca  a g  a       a                  C  A  --    ccuu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr6: 3721897-3722003 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-489
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-489-3p

Accession MIMAT0003112
Description Mus musculus mmu-miR-489-3p mature miRNA
Sequence 60 - AAUGACACCACAUAUAUGGCAGC - 82
Evidence experimental
cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-489-5p

Accession MIMAT0022704
Description Mus musculus mmu-miR-489-5p mature miRNA
Sequence 23 - UGUCAUAUGUGUGAUGACACUUUCU - 47
Evidence not_experimental

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267