Stem-loop sequence fru-mir-133

AccessionMI0003397 (change log)
DescriptionFugu rubripes miR-133 stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
   ---aau  uuu    a       aa  u  a        accuc 
5'       gc   gcua agcuggu  aa gg accaaauc     u
         ||   |||| |||||||  || || ||||||||      
3'       cg   cgau ucgacca  uu cc ugguuuag     u
   uaguuu  uau    g       ac  c  c        guaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602556.1: 1377140-1377226 [-]
intergenic
Clustered miRNAs
< 10kb from fru-mir-133
fru-mir-1HE602556.1: 1379732-1379807 [-]
fru-mir-133HE602556.1: 1377140-1377226 [-]
Database links

Mature sequence fru-miR-133

Accession MIMAT0003057
Sequence

51 - 

uuugguccccuucaaccagcug

 - 72

Get sequence
Evidence by similarity; MI0001993